Tag Archives: frequencies

Science

Nuclear chromosome locations dictate segregation error frequencies

Leave a comment

Cell culture

Cell lines RPE1-hTERT (Flp-In) (a gift from the laboratory of P. Jallepalli), Caco-2 (a gift from the laboratory of H. Clevers), HeLa (a gift from the laboratory of M. Vermeulen), HT-29 (a gift from the laboratory of H. Clevers), U2OS (a gift from the laboratory of S. Lens) and WiDr (a gift from the laboratory of H. Clevers) were cultured in DMEM/F12 and GlutaMAX supplement (Gibco), supplemented with 9% foetal bovine serum (FBS, Sigma-Aldrich) and 1% penicillin/streptomycin (Sigma-Aldrich). Cell lines U2OS DamID, U2OS CENPA and BJ-hTERT (a gift from the laboratory of R. Medema), HCT116 (a gift from the laboratory of H. Clevers) and HT1080 were cultured in DMEM, high-glucose GlutaMAX supplement and pyruvate (Gibco), supplemented with 10% FBS and 1% penicillin/streptomycin. Human small intestine duodenum and ileum organoids (a gift from the laboratory of H. Clevers) were cultured as described previously51. Rather than WNT conditioned medium, WNT surrogate was used (0.15 nM, U-Protein Express). DLD1 cells (a gift from D. Cimini) were cultured in RPMI and GlutaMAX supplement (Gibco), supplemented with 9% FBS and 50 μg ml–1 penicillin/streptomycin. To generate RPE1-hTERT Flp-in H2B-mNeon cells, cells were transduced with a lentivirus containing an H2B-mNeon-IRES-puromycin construct. Selection was performed with 10 μg ml–1 puromycin (Sigma-Aldrich) for 48 h. Organoids were transduced with the same construct without selection. Tetraploid RPE1-hTERT cells were generated by treatment of original RPE1-hTERT cells with 62.5 nM Cpd-5 for 48 h every 7 days for 4 weeks, after which tetraploid colonies grew out for an additional 22 weeks. Monoclonal RPE1-hTERT dCas9-3×GFP and DLD1 dCas9-GFP-3×FKBP FRB-mCherry-LaminB1 lines were generated by transduction with a dCas9-3×GFP or dCas9-GFP-3×FKBP lentivirus, followed by single-cell sorting. Next, FRB-mCherry-LaminB1 was lentivirally introduced in DLD1 cells. HT1080 cells containing a LacO-array in chromosome 11 (a gift from W. Bickmore) were transduced with LacI-GFP-FKBP and FRB-mCherry-LaminB1 and cloned by single-cell sorting. Cell lines were tested for mycoplasma contamination and not authenticated.

scKaryo-seq

RPE1-hTERT Flp-in cells were plated in a six-well plate (Corning) at 40% confluency and treated with palbociclib (250 nM; Selleck Chemicals). After 24 h, cells were washed three times with warm medium and treated with RO-3306 (5 μM; Tocris Bioscience). After 16 h, cells were washed three times for 5 min at 37 °C with warm medium containing DMSO, Cpd-5 (62.5 nM; a gift from R. Medema) or monastrol (200 μM; Sigma-Aldrich). Cpd-5-treated cells were cultured for a further 4 h before harvesting. Monastrol-treated cells were washed three times with warm medium containing 62.5 nM Cpd-5. Mitotic cells were collected by shake-off and plated in a new well of a six-well plate for 4 h. BJ-hTERT cells were plated in a six-well plate at 40% confluency and treated with 31.25 nM Cpd-5 for 16 h. All cells were trypsinized and stored at −20 °C for further processing. Single G1 nuclei of RPE1-hTERT Flp-in cells or single nuclei of BJ-hTERT cells were sorted as described previously8. Human intestinal organoids were plated 1 day before treatment for 16 h with 5 μM ZM447439 (Selleck Chemicals) or 10 μM EdU (Thermofisher) for 3 h, washed three times for 5 min with warm medium, incubated with 62.5 nM Cpd-5 for 16 h and fixed using 70% ice-cold ethanol. Ethanol was removed by one wash with PBS, and cells were incubated for 10 min with the Click-iT reaction cocktail (Click-iT EdU proliferation assay). The reaction cocktail was washed away and replaced with a PBS/DAPI mix. Single G1 nuclei in the case of ZM447439 or EdU-positive G1 cells were sorted in 384-well plates. Tetraploid RPE1-hTERT cells were plated at 40% confluency and treated with 62.5 nM Cpd-5 for 24 h. G1 nuclei were sorted. HCT116 cells were synchronized for 16 h using monastrol, released and treated with Cpd-5 as described for RPE1-hTERT cells. Plates were stored at −20 °C. NlaIII-based library preparation was performed as described previously, with several modifications8. Cell lysis was performed for 2 h at 55 °C with 8 mg ml–1 Proteinase K (Fisher Scientific) in 1× CutSmart (New England Biolabs) and heat inactivation at 80 °C for 10 min. Adaptors were ligated with 100 nl of 100 nM barcoded, double-stranded NLAIII adaptors and 400 nl of 10 U T4 DNA ligase (New England Biolabs) in 1× T4 DNA ligase buffer (New England Biolabs), supplemented with 3 mM ATP (Invitrogen) at 16 °C overnight. Samples were sequenced on an Illumina NextSeq500 or 2000 at 1× 75 or 1× 100 base pairs (bp), respectively. After sequencing, mapping (bwa aln 0.7.12 and python 2.7.5) and Aneufinder (v.1.2.0) plotting and copy number variations of whole and partial chromosomes were determined manually. Chromosome 8 of human intestinal organoids was not quantified because this chromosome was heterogeneously aneuploid under the control condition.

Centromere FISH

Cells were plated on 12-mm round glass coverslips (Superior Marienfeld). To validate scKaryo-seq segregation error bias, cells were synchronized and treated with Cpd-5 as described above. Cells were fixed 45 min after release from RO-3306, at −20 °C with 75% methanol and 25% acetic acid. To determine the distance of chromosomes from the centre of the nucleus, cells were plated 1 day before fixation. To determine nuclear chromosome territories of monastrol-treated mitotic cells, cells were synchronized as described above and incubated for 4 h in monastrol, then subsequently fixed. After fixation, coverslips were air-dried and incubated for 2 min with 2× saline-sodium citrate (SSC) at room temperature. Coverslips were washed in series with 70%, 85% and 100% ethanol and air-dried. Next, 1.2 μl of a red and green satellite enumeration probe (Cytocell) and 1.6 μl of hybridization solution per coverslip were spotted on a glass slide. Coverslips were placed upside down on the probe solution and incubated at 75 °C for 2 min. Coverslips were incubated at room temperature for 4–16 h, followed by 2 min incubation at 72 °C with 0.25× SSC (pH 7.0). Coverslips were washed for 30 s with 2× SSC 0.5% Tween-20 at room temperature, incubated with DAPI and mounted using ProLong Gold antifade (Molecular Probes).

Image acquisition was done on a DeltaVision RT system (Applied Precision/GE Healthcare) with a ×1.40/100 numerical aperture (NA) UplanSApo objective (Olympus) as z-stacks at 0.5 μm intervals. For deconvolution, SoftWorx (Applied Precision/GE Healthcare, v.6.5.2) was used. Image analysis and quantification was done using Fiji ImageJ (v.2.0.0).

FISH segregation error frequencies were determined by counting the number of mis-segregating FISH-positive chromosomes and dividing that by the total number of mis-segregating chromosomes.

Chromosomes in low-dose nocodazole were considered misaligned when FISH-positive chromosomes were physically separated from the metaphase plate; this number was then divided by the total number of FISH-positive chromosomes.

To measure the distance of chromosomes from the centre of the nucleus, we determined the centroid X and Y coordinates of the three different thresholded channels (DAPI, red probe and green probe). The centre of monastrol-treated cells was determined using a custom ImageJ script, which measures the centre of mass of thresholded DAPI particles.

Live imaging

To time mitotic phases, RPE1-hTERT Flp-in H2B-mNeon cells were plated in a black, glass-bottom, 96-well plate (Corning) at 40% confluency and synchronized as described for scKaryo-seq. Cells were imaged on an Andor CSU-W1 spinning disk (50 µm disk) with a ×0.75/20 NA dry objective lens (Nikon). A 488 nm laser was used for sample excitation, with filters between 540 and 50 nm bandpass for emission. Images were acquired using an Andor iXon-888 EMCCD camera. Nine z-slices of 2 μm were imaged for 4 h every 1 min. NEBD was defined as one frame before extensive chromosome movement. Images were acquired using NIS-elements (Nikon, v.5.30.04).

To determine the time from condensation to anaphase onset and segregation errors, we used a Nikon Ti-E motorized microscope equipped with a Zyla 4.2Mpx sCMOS camera (Andor) and a ×1.3/40 NA oil objective lens (Nikon). Fluorescence excitation was done using a Spectra X LED illumination system (Lumencor) and Chroma-ET filter sets. Nine z-slices of 2 μm were imaged every 4 min for 4 h. The same videos were also used to determine cell survival.

To examine cell survival for MN-seq, RPE1-hTERT Flp-in and BJ-hTERT cells were plated at 40% confluency. Cells were imaged on the same microscope used for determination of segregation errors. DIC and a ×0.45/10 NA objective lens (Nikon) were used to visualize cells every 3–5 min for 16 h.

Human intestinal organoids were imaged as described previously8.

To determine mis-segregations in cells treated with low-dose nocodazole, RPE1-hTERT H2B-eYFP cells were plated at 40% confluency 1 day before imaging. Next, cells were treated with nocodazole (48 nM; Sigma-Aldrich) and imaged on an Andor CSU-W1 spinning disk (50 µm disk) with a ×1.45/100 NA oil objective lens (Nikon). A 488 nm laser was used for sample excitation and filters between 540 and 50 nm bandpass for emission. Images were acquired using an Andor iXon-888 EMCCD camera. Nine z-slices of 2 μm were imaged for 16 h every 3 min.

To compare the behaviour of polar and non-polar chromosomes, RPE1-hTERT cells stably expressing both CENPA-GFP and Centrin1-GFP (a gift from A. Khodjakov) were imaged on the Expert Line easy3D STED microscope system (Abberior Instruments) using Prairie View (5.4.64.500) and Imspector (Abberior Instruments, v.16.3) with 485 and 640 nm lasers using a ×60/1.2 UPLSAPO 60×W water objective (Olympus) and an avalanche photodiode (APD) detector. Low-dose (1:100,000) SPY-595-DNA was added to detect the moment of nuclear envelope breakdown, and low-dose (1:50,000) SPY-640-tubulin (Spirochrome, AG) was added to distinguish between poles and kinetochores, as well as to enable pole tracking when the Centrin1 signal was not easily detectable in a specific frame. Six z-slices of 1 μm were taken every 20 s. Immediately after nuclear envelope breakdown, the edges of the nucleus were manually drawn to determine the relative nuclear position of tracked chromosomes by dividing the nucleus into three equally spaced concentric areas. Chromosomes were considered central if they resided in the two innermost shells or were touching the second-most outer ring. Positions of both centrosomes were also determined at that point. Each kinetochore pair was followed manually in a maximum-intensity projection. The positions and trajectories of the kinetochore pairs were additionally verified in single z-planes of a z-stack in Fiji (v.1.53f51/1.53s30/1.53r), as well as in Imaris 3D Viewer (v.9.8.0). One pair each of polar and non-polar peripheral chromosomes with the same distance to the metaphase plate were selected from the same cell.

U2OS kinetochore tracking experiments were performed with a U2OS cell line stably expressing CENPA-GFP, mCherry-α-tubulin and photoactivatable-GFP-α-tubulin (a gift from M. Barisic and H. Maiato). Cells were imaged using a Bruker Opterra I multipoint scanning confocal microscope system, as previously described52. Image acquisition was performed at 1 min intervals with z-stacks of 15 slices at 1 μm spacing. Misaligned kinetochores included all pairs of kinetochores displaced from the metaphase plate in the frame when elongation of the prometaphase spindle reached its peak, which was defined as the final point at which the separation of two centrosomes showed a continuous increase in spindle length for two consecutive frames >1 μm. Spatial x and y coordinates of unaligned kinetochores were extracted in every time frame using the Low Light Tracking Tool (v.0.10), an ImageJ plugin, as previously described53. The tracking of kinetochores in x and y planes was performed on individual imaging z-planes. Around 10–15% of unaligned kinetochore pairs could not be successfully tracked in all frames, mainly owing to cell and spindle movements in the z-direction over time. Spindle poles were manually tracked with points placed in the centre of the pole structure, in the z-plane in which the tubulin signal was highest. Aligned kinetochore pairs were manually tracked in two dimensions. All unaligned pairs in the NEBD frame were double-checked as being ‘behind spindle poles’ using a 3D Imaris Viewer. Lagging chromosomes were defined as a single kinetochore that was stuck and stretched between the separating mass of kinetochores during early anaphase. Chromosome bridges included cells with a kinetochore pair that was well separated but remained between the separating mass of kinetochores during early anaphase. Misalignments included cells that had at least one pair of kinetochores at the pole during anaphase, and the ‘no error’ phenotype was defined as a cell with absence of the aforementioned phenotypes. Multipolar cells (one out of 190) were not included in the analysis. Quantitative analysis of all parameters was performed using custom-made MATLAB (MatlabR2021a 9.10.0) scripts.

For live tracking of individual chromosomes, RPE1-hTERT dCas9-3×GFP were transduced with lentiviruses containing single-guide RNAs targeting chromosome 1 (ATGCTCACCT) and chromosome 9 (TGGAATGGAATGGAATGGAA). 24 h post transduction, cells were plated in an optical-quality, plastic, eight‐well slide (IBIDI) at 50% confluency. After 16 h, asynchronous mitotic cells were treated with 62.5 nM Cpd-5 and immediately imaged using a ×1.4/40 NA oil PLAN Apochromat lens on a Zeiss Cell Observer microscope equipped with a AxioImager Z1 stand, a Hamamatsu ORCA‐flash 4.0 camera and a Colibri 7 LED. Images were acquired every 2.5 min for 4.2 h. Videos were subsequently processed and analysed using ZEN software (Zeiss, v.3.3).

Chromosome 9 tracking and tethering experiments were performed on the spinning-disk system as previously described, with several adaptations; 500 nM rapalog (Takara) was added 24 h before imaging of DLD1 cells and 62.5 nM Cpd-5 was added immediately before imaging. We used a ×1.20/60 NA water phase immersion oil lens, and 16 z-slices of 1 μm were imaged every 3 min overnight.

Cells were imaged at 37 °C in 5% CO2 for all imaging experiments.

MN-seq

RPE1-hTERT Flp-in cells were plated in a six-well plate at 40% confluency and treated with Cpd-5 or nocodazole for 16 h. Cancer cell lines were plated in a similar fashion, but were not treated with any drugs. Preparations for FACS were performed similarly to the method described previously33. In short, cells were incubated on ice for 30 min under light with PBS/2% FBS and 12.5 μg ml–1 EMA (ThermoFisher). EMA was washed four times using PBS, and (micro)nuclei were harvested from cells with the same nuclear staining buffer used for scKaryo-seq. EMA-negative and Hoechst-positive (micro)nuclei were sorted in bulk in a PCR strip containing mineral oil and stored at −20 °C for further processing. Library preparation was performed similarly to scKaryo-seq, but with several modifications. Every 5 μl of sorted (micro)nuclei was incubated with 5 μl of lysis buffer (final concentration, 0.02 U Proteinase K μl–1 (NEB) in 1× CutSmart Buffer (NEB)) for 2 h at 55 °C and 10 min at 80 °C. Genomic DNA was digested by incubation of (micro)nuclei with 10 μl of digestion mix (final concentration, 0.5 U NLAIII μl–1 (New England Biolabs) in 1× CutSmart Buffer) for 2 h at 37 °C, followed by 20 min at 65 °C. Genomic DNA fragments were subsequently ligated to adaptors by the addition of 20 μl of ligation mix (final concentration, 20 U μl–1 T4 DNA ligase (New England Biolabs), 0.5 mM ATP (ThermoFisher) and 25 nM adaptor in 0.5× T4 DNA ligase buffer (New England Biolabs), with incubation at 16 °C overnight. After ligation, the remainder of library preparation, sequencing and analysis was performed as described for scKaryo-seq. To determine the percentage of reads per chromosome, all reads mapped to a specific chromosome were summed and normalized by dividing this by the number of bins for that specific chromosome. The percentage of reads for chromosome 10 in RPE1-hTERT cells was normalized using bulk-sequenced nuclei, because the q-arm of this chromosome is present in three copies.

DamID

U2OS DamID sequencing data were generated in bulk from clonal cell lines stably expressing Dam-LaminB1 or untethered Dam protein. DamID data from Shield1-inducible DamID U2OS cells were derived by transfection of Dam-LaminB1 or Dam constructs (cloned into the pPTuner IRES2 vector (Clontech, Takara)), antibiotic resistance selection with 500 µg ml–1 G418 (Gibco) and subsequent characterization of monoclonal cell populations. Selection of suitable clones was based on methylation concentrations at known LAD or iLAD genomic regions, measured by quantitative MboI-based PCR and DamID as previously described54. Stabilization of Dam proteins was achieved by the addition of Shield1 ligand (AOBIOUS) to the cell culture medium at 500 nM final concentration for 18–24 h before cell collection. Multiplexed DamID was performed as previously described54 and sequenced on an Illumina NextSeq 500 platform (1× 50 bp). Raw reads were demultiplexed by their library-specific index and sample-specific DamID barcode, universal DamID adaptor sequence was trimmed with cutadapt (v.1.16) and reads were aligned to reference genome hg19 using bowtie2 (v.2.3.4). Reads mapping to annotated GATC sites were counted and aggregated in genomic bins of 100 kb. Computation of observed over expected values per bin was performed as previously described55.

Statistics

Statistical analyses were performed using GraphPad Prism software (v.8.4.3). Superplots were used in many of the graphs in which each colour represents a replicate, the small dots individual measurements and large dots the mean of each replicate.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.

Read original article here

Science

These Eerie Wails Are a Real Sound Wave From a Supermassive Black Hole

Leave a comment

We might not be able to hear sound in space, but that doesn’t mean there isn’t any. In 2003, astronomers detected something truly astonishing: acoustic waves propagating through the gas surrounding a supermassive black hole, 250 million light-years away.

 

We wouldn’t be able to hear them at their current pitch. Emanating from the supermassive black hole at the center of the Perseus cluster of galaxies, the waves include the lowest note in the Universe ever detected by humans – well below the limits of human hearing.

A new sonification (data turned into sound) however, has not only added to the notes detected from the black hole, but brought them up 57 and 58 octaves so we can get a sense of what they would sound like, ringing through intergalactic space.

It’s the first time these sound waves have been extracted and made audible.

The lowest note, the one identified back in 2003, is a B-flat, just over 57 octaves below middle C; at that pitch, its frequency is 10 million years. The lowest note detectable by humans has a frequency of one-twentieth of a second.

The sound waves were extracted radially, or outwards from the supermassive black hole at the center of the Perseus cluster, and played in an anticlockwise direction from the center, so that we can hear the sounds in all directions from the supermassive black hole at pitches 144 quadrillion and 288 quadrillion times higher than their original frequency.

The result is an eerie one, a sort of unearthly (obviously) howling, like many of the waves recorded from space and transposed into audio frequencies.

The sounds aren’t just a scientific curiosity, though. The tenuous gas and plasma that drifts between the galaxies in galaxy clusters – known as the intracluster medium – is denser and much, much hotter than the intergalactic medium outside galaxy clusters.

Sound waves propagating through the intracluster medium is one mechanism whereby the intracluster medium can be heated, as they transport energy through the plasma.

 

Because temperatures help regulate star formation, sound waves might therefore play a vital role in the evolution of galaxy clusters over long periods of time.

That heat is what allows us to detect the sound waves, too. Because the intracluster medium is so hot, it glows brightly in X-rays. The Chandra X-ray Observatory allowed not only for the detection of the sound waves initially, but for the sonification project.

Another famous supermassive black hole also got the sonification treatment. M87*, the first black hole ever to be directly imaged in a colossal effort by the Event Horizon Telescope collaboration, was also imaged by other instruments at the same time. Those include Chandra for X-rays, Hubble for visible light, and the Atacama Large Millimeter/submillimeter Array for radio wavelengths.

Those images showed a colossal jet of material being launched from the space immediately outside the supermassive black hole, at speeds that appear faster than that of light in a vacuum (it’s an illusion, but a cool one). And now, they too have been sonified.

To be clear, these data were not sound waves to start with, like the Perseus audio, but light in different frequencies. The radio data, at the lowest frequencies, have the lowest pitch in the sonification. Optical data hold the middle range, and X-rays are at the top.

Turning visual data like these into sound can be a cool new way to experience cosmic phenomena, and the method has scientific value, too.

Sometimes, transforming a dataset can reveal hidden details, allowing for more detailed discoveries about the mysterious and vast Universe around us.

 

Read original article here

Science

The Tiny Dots in This Image Aren’t Stars or Galaxies. They’re Black Holes

Leave a comment

The image above may look like a fairly normal picture of the night sky, but what you’re looking at is a lot more special than just glittering stars. Each of those white dots is an active supermassive black hole.

 

And each of those black holes is devouring material at the heart of a galaxy millions of light-years away – that’s how they could be pinpointed at all.

Totaling 25,000 such dots, astronomers created the most detailed map to date of black holes at low radio frequencies in early 2021, an achievement that took years and a Europe-sized radio telescope to compile.

“This is the result of many years of work on incredibly difficult data,” explained astronomer Francesco de Gasperin of the University of Hamburg in Germany. “We had to invent new methods to convert the radio signals into images of the sky.”

(LOFAR/LOL Survey)

When they’re just hanging out not doing much, black holes don’t give off any detectable radiation, making them much harder to find. When a black hole is actively accreting material – spooling it in from a disc of dust and gas that circles it much as water circles a drain – the intense forces involved generate radiation across multiple wavelengths that we can detect across the vastness of space.

What makes the above image so special is that it covers the ultra-low radio wavelengths, as detected by the LOw Frequency ARray (LOFAR) in Europe. This interferometric network consists of around 20,000 radio antennas, distributed throughout 52 locations across Europe.

 

Currently, LOFAR is the only radio telescope network capable of deep, high-resolution imaging at frequencies below 100 megahertz, offering a view of the sky like no other. This data release, covering four percent of the Northern sky, was the first for the network’s ambitious plan to image the entire Northern sky in ultra-low-frequencies, the LOFAR LBA Sky Survey (LoLSS).

Because it’s based on Earth, LOFAR does have a significant hurdle to overcome that doesn’t afflict space-based telescopes: the ionosphere. This is particularly problematic for ultra-low-frequency radio waves, which can be reflected back into space. At frequencies below 5 megahertz, the ionosphere is opaque for this reason.

The frequencies that do penetrate the ionosphere can vary according to atmospheric conditions. To overcome this problem, the team used supercomputers running algorithms to correct for ionospheric interference every four seconds. Over the 256 hours that LOFAR stared at the sky, that’s a lot of corrections.

This is what has given us such a clear view of the ultra-low-frequency sky.

“After many years of software development, it is so wonderful to see that this has now really worked out,” said astronomer Huub Röttgering of Leiden Observatory in the Netherlands.

 

Having to correct for the ionosphere has another benefit, too: It will allow astronomers to use LoLSS data to study the ionosphere itself. Ionospheric traveling waves, scintillations, and the relationship of the ionosphere with solar cycles could be characterized in much greater detail with the LoLSS. This will allow scientists to better constrain ionospheric models.

And the survey will provide new data on all sorts of astronomical objects and phenomena, as well as possibly undiscovered or unexplored objects in the region below 50 megahertz.

“The final release of the survey will facilitate advances across a range of astronomical research areas,” the researchers wrote in their paper.

“[This] will allow for the study of more than 1 million low-frequency radio spectra, providing unique insights on physical models for galaxies, active nuclei, galaxy clusters, and other fields of research. This experiment represents a unique attempt to explore the ultra-low frequency sky at a high angular resolution and depth.”

The results have been published in Astronomy & Astrophysics.

A version of this article was first published in February 2021.

 

Read original article here

Science

Here’s Why Earthquakes’ ‘Four-Leaf Clover’ Shockwaves Are Dangerous Instead of Lucky

Leave a comment

Geologists have measured a devastating ‘four-leaf clover’ pattern of earthquake shockwaves in greater detail than ever before – and the resulting findings could be crucial in making our buildings and cities more resistant to large quakes in the future.

 

This four-pronged pattern has been analyzed before, but never in as much depth as this. The team behind the new study is hoping that it might remove some of the mystery surrounding how earthquake shockwaves spread out across different frequencies.

Crucially, the cloverleaf shockwaves spread at low frequencies of under 10 hertz, a level of vibration that many buildings and structures are particularly vulnerable to.

The four-leaf clover pattern is visible at lower frequencies. (Trugman et al., Geophysical Research Letters, 2021)

“We find that at low frequencies, a simplified and widely used four-lobed model of earthquake ground motions does a good job describing the observed seismic wavefield,” write the researchers in their published paper.

“At higher frequencies, however, this four-lobed radiation pattern becomes less clear, deteriorating due to complexity in earthquake source processes and fault zone structure.”

The researchers looked at data from one of the densest seismic arrays on the planet: the LArge-n Seismic Survey in Oklahoma (LASSO), which is made up of 1,829 seismic sensors within an area of just 15 by 20 miles (25 by 32 kilometers).

LASSO was used to measure P-wave data from 24 small earthquakes across a period of 28 days in 2016, and it’s this data that the new study digs into. Having sensors so close to the epicenter of the quakes meant that patterns could be spotted before they smoothed out and evened off over greater distances.

 

By using algorithms to filter shockwaves by frequency, the four-leaf clover pattern emerged, but only at the lower frequencies. That might be because lower frequency seismic waves can bypass the jumble of broken rock found at earthquake faults, rather than being reflected and scattered in many different directions.

“What happens when you have an earthquake is that pieces of broken rock inside the fault zone start to move around like pinballs,” says geophysicist Victor Tsai, from Brown University in Rhode Island.

The earthquakes recorded by the LASSO array were relatively small – barely perceptible to the sensors – but the same patterns should be repeated across stronger quakes, the researchers predict. The next step is to put that to the test.

Ultimately, new data like this can make earthquake assessments and modeling more accurate. It shows that while people on the ground might experience a consistent level of shockwaves (the higher frequency ones), the buildings around them might be under a greater or lesser level of stress (the lower frequency shockwaves), depending on where they are in the four-leaf clover pattern.

While earthquake faults vary in terms of their age, their geological composition, and other factors, the underlying physics should be the same. The scientists are hoping to put together a catalog of earthquake zones, showing the faults with the most potential for dangerous seismic waves and resulting damage.

“What’s important in these results is that close to the source we’re seeing a variation in ground motion, and that’s not accounted for in any sort of hazard model,” says the study’s first author, earthquake geophysicist Daniel Trugman from the University of Texas at Austin.

The research has been published in Geophysical Research Letters.

 

Read original article here

Science

The White Dots in This Image Are Not Stars or Galaxies. They’re Black Holes

Leave a comment

The image above may look like a fairly normal picture of the night sky, but what you’re looking at is a lot more special than just glittering stars. Each of those white dots is an active supermassive black hole.

 

And each of those black holes is devouring material at the heart of a galaxy millions of light-years away – that’s how they could be pinpointed at all.

Totalling 25,000 such dots, astronomers have created the most detailed map to date of black holes at low radio frequencies, an achievement that took years and a Europe-sized radio telescope to compile.

“This is the result of many years of work on incredibly difficult data,” explained astronomer Francesco de Gasperin of the University of Hamburg in Germany. “We had to invent new methods to convert the radio signals into images of the sky.”

(LOFAR/LOL Survey)

When they’re just hanging out not doing much, black holes don’t give off any detectable radiation, making them much harder to find. When a black hole is actively accreting material – spooling it in from a disc of dust and gas that circles it much as water circles a drain – the intense forces involved generate radiation across multiple wavelengths that we can detect across the vastness of space.

What makes the above image so special is that it covers the ultra-low radio wavelengths, as detected by the LOw Frequency ARray (LOFAR) in Europe. This interferometric network consists of around 20,000 radio antennas, distributed throughout 52 locations across Europe.

 

Currently, LOFAR is the only radio telescope network capable of deep, high-resolution imaging at frequencies below 100 megahertz, offering a view of the sky like no other. This data release, covering four percent of the Northern sky, is the first for the network’s ambitious plan to image the entire Northern sky in ultra-low-frequencies, the LOFAR LBA Sky Survey (LoLSS).

Because it’s based on Earth, LOFAR does have a significant hurdle to overcome that doesn’t afflict space-based telescopes: the ionosphere. This is particularly problematic for ultra-low-frequency radio waves, which can be reflected back into space. At frequencies below 5 megahertz, the ionosphere is opaque for this reason.

The frequencies that do penetrate the ionosphere can vary according to atmospheric conditions. To overcome this problem, the team used supercomputers running algorithms to correct for ionospheric interference every four seconds. Over the 256 hours that LOFAR stared at the sky, that’s a lot of corrections.

This is what has given us such a clear view of the ultra-low-frequency sky.

“After many years of software development, it is so wonderful to see that this has now really worked out,” said astronomer Huub Röttgering of Leiden Observatory in the Netherlands.

 

Having to correct for the ionosphere has another benefit, too: it will allow astronomers to use LoLSS data to study the ionosphere itself. Ionospheric travelling waves, scintillations, and the relationship of the ionosphere with solar cycles could be characterised in much greater detail with the LoLSS. This will allow scientists to better constrain ionospheric models.

And the survey will provide new data on all sorts of astronomical objects and phenomena, as well as possibly undiscovered or unexplored objects in the region below 50 megahertz.

“The final release of the survey will facilitate advances across a range of astronomical research areas,” the researchers wrote in their paper.

“[This] will allow for the study of more than 1 million low-frequency radio spectra, providing unique insights on physical models for galaxies, active nuclei, galaxy clusters, and other fields of research. This experiment represents a unique attempt to explore the ultra-low frequency sky at a high angular resolution and depth.”

The results are due to be published in Astronomy & Astrophysics.

 

Read original article here

Science

Distant ‘Baby’ Black Holes Are Behaving Strangely, And Scientists Are Perplexed

Leave a comment

Radio images of the sky have revealed hundreds of ‘baby’ and supermassive black holes in distant galaxies, with the galaxies’ light bouncing around in unexpected ways.

Galaxies are vast cosmic bodies, tens of thousands of light years in size, made up of gas, dust, and stars (like our Sun).

 

Given their size, you’d expect the amount of light emitted from galaxies would change slowly and steadily, over timescales far beyond a person’s lifetime.

But our research, published in the Monthly Notices of the Royal Astronomical Society, found a surprising population of galaxies whose light changes much more quickly, in just a matter of years.

What is a radio galaxy?

Astronomers think there’s a supermassive black hole at the centre of most galaxies. Some of these are ‘active’, which means they emit a lot of radiation.

Their powerful gravitational fields pull in matter from their surroundings and rip it apart into an orbiting donut of hot plasma called an ‘accretion disk’.

This disk orbits the black hole at nearly the speed of light. Magnetic fields accelerate high-energy particles from the disk in long, thin streams or ‘jets’ along the rotational axes of the black hole. As they get further from the black hole, these jets blossom into large mushroom-shaped clouds or ‘lobes’.

This entire structure is what makes up a radio galaxy, so called because it gives off a lot of radio-frequency radiation. It can be hundreds, thousands or even millions of light years across and therefore can take aeons to show any dramatic changes.

 

Astronomers have long questioned why some radio galaxies host enormous lobes, while others remain small and confined. Two theories exist. One is that the jets are held back by dense material around the black hole, often referred to as frustrated lobes.

However, the details around this phenomenon remain unknown. It’s still unclear whether the lobes are only temporarily confined by a small, extremely dense surrounding environment – or if they’re slowly pushing through a larger but less dense environment.

The second theory to explain smaller lobes is the jets are young and have not yet extended to great distances.

Hercules A’s supermassive black hole emitting high energy particle jets into radio lobes.  (NASA/ESA/NRAO)

Old ones are red, babies are blue

Both young and old radio galaxies can be identified by a clever use of modern radio astronomy: looking at their ‘radio colour’.

We looked at data from the GaLactic and Extragalactic All Sky MWA (GLEAM) survey, which sees the sky at 20 different radio frequencies, giving astronomers an unparalleled ‘radio colour’ view of the sky.

 

From the data, baby radio galaxies appear blue, which means they’re brighter at higher radio frequencies. Meanwhile the old and dying radio galaxies appear red and are brighter in the lower radio frequencies.

We identified 554 baby radio galaxies. When we looked at identical data taken a year later, we were surprised to see 123 of these were bouncing around in their brightness, appearing to flicker. This left us with a puzzle.

Something more than one light year in size can’t vary so much in brightness over less than one year without breaking the laws of physics. So, either our galaxies were far smaller than expected, or something else was happening.

Luckily, we had the data we needed to find out.

Past research on the variability of radio galaxies has used either a small number of galaxies, archival data collected from many different telescopes, or was conducted using only a single frequency.

For our research, we surveyed more than 21,000 galaxies over one year across multiple radio frequencies. This makes it the first ‘spectral variability’ survey, enabling us to see how galaxies change brightness at different frequencies.

 

Some of our bouncing baby radio galaxies changed so much over the year we doubt they are babies at all. There’s a chance these compact radio galaxies are actually angsty teens rapidly growing into adults much faster than we expected.

While most of our variable galaxies increased or decreased in brightness by roughly the same amount across all radio colours, some didn’t. Also, 51 galaxies changed in both brightness and colour, which may be a clue as to what causes the variability.

Artist’s impression of SKA-mid (left) and SKA-low (right) telescopes. (SKAO/ICRAR/SARAO)

Three possibilities for what is happening

1) Twinkling galaxies

As light from stars travels through Earth’s atmosphere, it is distorted. This creates the twinkling effect of stars we see in the night sky, called ‘scintillation’. The light from the radio galaxies in this survey passed through our Milky Way galaxy to reach our telescopes on Earth.

Thus, the gas and dust within our galaxy could have distorted it the same way, resulting in a twinkling effect.

2) Looking down the barrel

In our three-dimensional Universe, sometimes black holes shoot high energy particles directly towards us on Earth. These radio galaxies are called ‘blazars’.

Instead of seeing long thin jets and large mushroom-shaped lobes, we see blazars as a very tiny bright dot. They can show extreme variability in short timescales, since any little ejection of matter from the supermassive black hole itself is directed straight towards us.

3) Black hole burps

When the central supermassive black hole ‘burps’ some extra particles they form a clump slowly travelling along the jets. As the clump propagates outwards, we can detect it first in the ‘radio blue’ and then later in the ‘radio red’.

So we may be detecting giant black hole burps slowly travelling through space.

Where to now?

This is the first time we’ve had the technological ability to conduct a large-scale variability survey over multiple radio colours. The results suggest our understanding of the radio sky is lacking and perhaps radio galaxies are more dynamic than we expected.

As the next generation of telescopes come online, in particular the Square Kilometre Array (SKA), astronomers will build up a dynamic picture of the sky over many years.

In the meantime, it’s worth watching these weirdly behaving radio galaxies and keeping a particularly close eye on the bouncing babies, too.

Kathryn Ross, PhD Student, Curtin University and Natasha Hurley-Walker, Radio Astronomer, Curtin University.

This article is republished from The Conversation under a Creative Commons license. Read the original article.

 

Read original article here